superscript iii platinum one-step rt-qpcr kit (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
90
Structured Review
Thermo Fisher
superscript iii platinum one-step rt-qpcr kit
Superscript Iii Platinum One Step Rt Qpcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/superscript+iii+platinum+one-step+rt-qpcr+kit/high+capacity+cdna+reverse+transcription+kit/pm40601793-190-18-21
Average 90 stars, based on 1 article reviews
Superscript Iii Platinum One Step Rt Qpcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/superscript+iii+platinum+one-step+rt-qpcr+kit/high+capacity+cdna+reverse+transcription+kit/pm40601793-190-18-21
Average 90 stars, based on 1 article reviews
superscript iii platinum one-step rt-qpcr kit - by Bioz Stars,
2026-10
90/100 stars
Images
Related Articles
Quantitative RT-PCR:Article Title: The N gene protects tomato plants from tomato brown rugose fruit virus infection. Article Snippet: .. Briefly, each 20 lL reaction containing 400 ng of extracted RNA was prepared using the Article Title: Transcriptome profiling of macrophages persistently infected with human respiratory syncytial virus and effect of recombinant Taenia solium calreticulin on immune-related genes Article Snippet: .. One-step RT-qPCR reactions were carried out with Article Title: Gut Microbiome Signatures During Acute Infection Predict Long COVID Article Snippet: The samples were centrifuged at 20,000×g for 5 and then 1ml of supernatant was transferred into a bioMérieux eMAG (Marcy-l’Étoile, France) for total nucleic acid extraction. .. Detection of SARS-CoV-2 was performed by TaqMan-based RT-qPCR using Article Title: Crimean Congo hemorrhagic fever virus nucleoprotein and GP38 subunit vaccine combination prevents morbidity in mice. Article Snippet: Samples were treated with Baseline-ZERO DNase (LGC Biosearch) as part of the extraction protocol. .. All RT-qPCR assays were prepared in 384-well plates using the OT-2 LiquidHandler (Opentrons).Viral RNAwas quantified using a primer/probe set targeting theNPORF of the S genomic sequence using the Article Title: Inflammation associated with monocyte/macrophage activation and recruitment corresponds with lethal outcome in a mouse model of Crimean-Congo haemorrhagic fever 1 Article Snippet: MagMAX Pathogen RNA/DNA kits (Thermo Fisher Scientific, 4462359) were used in conjunction with the 96-well ABI MagMAX extraction platform; RNA was eluted into 75 μL of elution buffer. .. Viral RNA was quantified using a primer/probe set targeting either the NP open reading frame of the S genomic segment of CCHFV strain IbAr10200 (forward 5′-CAG GAC ATG GAC ATA GTG GC-3′; reverse: 5′-ATT GCC CTT GAC GTT GTA GG-3′; probe: 5′-CCC TTG TTG GCA AGC AAT CCC-3′) or Turkey04 (forward: 5′-CAA CAG GCT GCT CTC AAG TG -3′; reverse: 5′-CAA TTT CGC CAG GGA CTT TA-3′; probe: 5′-ACA CGG CAG CCT TAA GCA ACA A-3′ [all IDT]) using the Article Title: Lrp1 facilitates infection of neurons by Jamestown Canyon virus Article Snippet: .. RT-qPCR was performed using the Article Title: Replicon particle vaccination induces non-neutralizing anti-nucleoprotein antibody-mediated control of Crimean-Congo hemorrhagic fever virus. Article Snippet: .. MagMAX Pathogen RNA/DNA kits (Thermo Fisher, 4462359) were used in conjunction with the 96-well ABI MagMAX extractionplatform;RNAwas eluted into 75 μLof elution buffer.Viral RNA was quantified using a primer/probe set targeting the CCHFV Turkey04 strain NP ORF of the S genomic segment (forward: CAACAGGCTGCTCTCAAGTG; reverse: CAATTTCGCCAGGGACTTTA; probe: 56FAM/ACACGGCAG/ZEN/CCTTAAGCAACAA/3IABkFQ; IDT) using the other:Article Title: MDA5 ISGylation is crucial for immune signaling to control viral replication and pathogenesis Article Snippet: The quality and quantity of the extracted RNA were assessed using a Sequencing:Article Title: Crimean Congo hemorrhagic fever virus nucleoprotein and GP38 subunit vaccine combination prevents morbidity in mice. Article Snippet: Samples were treated with Baseline-ZERO DNase (LGC Biosearch) as part of the extraction protocol. .. All RT-qPCR assays were prepared in 384-well plates using the OT-2 LiquidHandler (Opentrons).Viral RNAwas quantified using a primer/probe set targeting theNPORF of the S genomic sequence using the Countercurrent Chromatography:Article Title: Inflammation associated with monocyte/macrophage activation and recruitment corresponds with lethal outcome in a mouse model of Crimean-Congo haemorrhagic fever 1 Article Snippet: MagMAX Pathogen RNA/DNA kits (Thermo Fisher Scientific, 4462359) were used in conjunction with the 96-well ABI MagMAX extraction platform; RNA was eluted into 75 μL of elution buffer. .. Viral RNA was quantified using a primer/probe set targeting either the NP open reading frame of the S genomic segment of CCHFV strain IbAr10200 (forward 5′-CAG GAC ATG GAC ATA GTG GC-3′; reverse: 5′-ATT GCC CTT GAC GTT GTA GG-3′; probe: 5′-CCC TTG TTG GCA AGC AAT CCC-3′) or Turkey04 (forward: 5′-CAA CAG GCT GCT CTC AAG TG -3′; reverse: 5′-CAA TTT CGC CAG GGA CTT TA-3′; probe: 5′-ACA CGG CAG CCT TAA GCA ACA A-3′ [all IDT]) using the |